GLDC (NM_000170) Human 3' UTR Clone

CAT#: SC207551

3`UTR clone of glycine dehydrogenase (decarboxylating) (GLDC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GLDC
• Synonyms: GCE; GCSP; HYGN1
• ACCN: NM_000170
• Insert Size: 596 bp
• Sequence Data:
  Insert Sequence

  >SC207551 3'UTR clone of NM_000170
  The sequence shown below is from the reference sequence of NM_000170. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTATGAGTCTCCATTTTCTGAACAAAAGAGGGCGTCTTCTTAGTCCTCTGTCCCTAAGTTTAAAGGAC
  TGATTTGATGCCTCTCCCCAGAGCATTTGATAAGCAAGAAAGATTTCATCTCCCACCCCAGCCTCAAGTA
  GGAGTTTTATATACTGTGTATATCTCTGTAATCTCTGTCAAGGTAAATGTAAATACAGTAGCTGGAGGGA
  GTCGAAGCTGATGGTTGGAAGACGGATTTGCTTTGGTATTCTGCTTCCACATGTGCCAGTTGCCTGGATT
  GGGAGCCATTTTGTGTTTTGCGTAGAAAGTTTTAGGAACTTTAACTTTTAATGTGGCAAGTTTGCAGATG
  TCATAGAGGCTATCCTGGAGACTTAATAGACATTTTTTTGTTCCAAAAGAGTCCATGTGGACTGTGCCAT
  CTGTGGGAAATCCCAGGGCAAATGTTTACATTTTGTATACCCTGAAGAACTCTTTTTCCTCTAATATGCC
  TAATCTGTAATCACATTTCTGAGTGTTCTCCTCTTTTTCTGTGTGAGGTTTTTTTTTTTTTAATCTGCAT
  TTATTAGTATTCTAATAAAAGCATCTTGATCGGAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000170.2
• Summary: 'Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]'
• Locus ID: 2731