HTRA2 (NM_013247) Human 3' UTR Clone

CAT#: SC207610

3`UTR clone of HtrA serine peptidase 2 (HTRA2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HTRA2
• Synonyms: MGCA8; OMI; PARK13; PRSS25
• ACCN: NM_013247
• Insert Size: 613
• Sequence Data:
  Insert Sequence

  >SC207610 3'UTR clone of NM_013247
  The sequence shown below is from the reference sequence of NM_013247. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACGAGAAACACTGACCTTATATGTGACCCCTGAGGTCACAGAATGAATAGATCACCAAGAGTATGAGGC
  TCCTGCTCTGATTTCCTCCTTGCCTTTCTGGCTGAGGTTCTGAGGGCACCGAGACAGAGGGTTAAATGAA
  CCAGTGGGGGCAGGTCCCTCCAACCACCAGCACTGACTCCTGGGCTCTGAAGAATCACAGAAACACTTTT
  TATATAAAATAAAATTATACCTAGCAACATATTATAGTAAAAAATGAGGTGGGAGGGCTGGATCTTTTCC
  CCCACCAAAAGGCTAGAGGTAAAGCTGTATCCCCCTAAACTTAGGGGAGATACTGGAGCTGACCATCCTG
  ACCTCCTATTAAAGAAAATGAGCTGCTGCCATCTTTTGTGGGCAGTTAGTCAGGTGCTGCTCTTTGTGGT
  GTGGTGGGCTCTGGTCTGTTCTGCTCGGTGCTGGGCCTGGGAGCAAAGATTCCCATGCTTGGCTACAGAT
  ACTGACAGCTGGCCTCTGAAGGAGGGTGAAAACTTCTGCTTGACAGTTCCACATCCATAGTGCATGGTCT
  GATGAGTGCGGTTGCTGACATGGGTTTCTTGGTAAGCTCCTGAGGTAATGGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013247.4
• Summary: This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
• Locus ID: 27429