LAPTM4A (NM_014713) Human 3' UTR Clone

CAT#: SC207633

3`UTR clone of lysosomal protein transmembrane 4 alpha (LAPTM4A) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LAPTM4A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LAPTM4A
Synonyms HUMORF13; LAPTM4; MBNT; Mtrp
ACCN NM_014713
Insert Size 548
Sequence Data
>SC207633 3'UTR clone of NM_014713
The sequence shown below is from the reference sequence of NM_014713. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTCCTTACTTACCTGCCTGAAGAAATTCTGCCTTTGACAATAAATCCTATACCAGCTTTTTGTTTGTTT
ATGTTACAGAATGCTGCAATTCAGGGCTCTTCAAACTTGTTTGATATAAAATATGTTGTCTTTTGTTTAA
GCATTTATTTTCAAACACTAAGGAGCTTTTTGACATCTGTTAAACGTCTTTTTGTTTTTTTGTTAAGTCT
TTTACATTTTAATAGTTTTTGAAGACAATCTAGGTTAAGCAAGAGCAAAGTGCCATTGTTTGCCTTTAAT
TGGGGGGTGGGAAGGGAAAGAGGGTACTTGCCACATAGTTTCCTTTTTAACTGCACTTTCTTTATATAAT
CGTTTGCATTTTGTTACTTGCTACCCTGAGTACTTTCAGGAAGACTGACTTAAATATTCGGGGTGAGTAA
GTAGTTGGGTATAAGATCTGAACTTTTCATCTGCAGAGGCAAGAAAAATATTTGACATTGTGACTTGACT
GTGGAAGATGATGGTTGCATGTTTCTAGTTTGTATATGTTTCCATCTTTGTGATAAGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014713.4
Summary This gene encodes a protein that has four predicted transmembrane domains. The function of this gene has not yet been determined; however, studies in the mouse homolog suggest a role in the transport of small molecules across endosomal and lysosomal membranes. [provided by RefSeq, Jul 2008]
Locus ID 9741

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.