CYP26A1 (NM_000783) Human 3' UTR Clone

CAT#: SC207711

3`UTR clone of cytochrome P450 family 26 subfamily A polypeptide 1 (CYP26A1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP26A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP26A1
Synonyms CP26; CYP26; P450RAI; P450RAI1
ACCN NM_000783
Insert Size 599 bp
Sequence Data
>SC207711 3'UTR clone of NM_000783
The sequence shown below is from the reference sequence of NM_000783. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGACAATCTCCCTGCAAGATTCACCCATTTCCATGGGGAAATCTGATGAGCTTGAATGTTCAAACCTGAG
ACTTATTGGAAGTGTACATATGAGTTTTTAAGGAGTGTTGTGTTGACTTTATATTTAATTTCTAAATGTA
TATTATAATATTTATGTGTTTTGACTATACTACCACAATCTTTAAATATTAAAATAATGAATTTGTATCA
TTTCCAAATAAAGTAAAATTTGAAGGTACTTTTCTGGTATTTTAAGATTCCTGTTGGGTAAAACTCACCA
GTTTAGTATTTTCTTAGTGTATTTAACCAGATTTTACAATGCCTACCTGGACTTATTTGTCATCTTTGCA
TCTGTTTTCTGTGAGAAGAAATCTTAGCTGTTTTTTATGTTAACAGTTATTAGAAAATATATGTCTGTGT
GTGTTATTCCAGACGTATCTCTGTAAATTCTTCTACAGTCACTTAGATTCCCTATTTGGAAAATTGATCC
AAGTTAATTTAATTTTTTTTTGGTTTGCTGTACTTTAGGGAAAGATGAACCTGAAAAGGTAACACTGAGA
ACTGTCACTCTAACCTCTCCAGCTTATCTAACATGTCAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000783.3
Summary 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]'
Locus ID 1592

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.