IGFBP1 (NM_000596) Human 3' UTR Clone

CAT#: SC207791

3`UTR clone of insulin-like growth factor binding protein 1 (IGFBP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IGFBP1
• Synonyms: AFBP; hIGFBP-1; IBP1; IGF-BP25; PP12
• ACCN: NM_000596
• Insert Size: 616 bp
• Sequence Data:
  Insert Sequence

  >SC207791 3'UTR clone of NM_000596
  The sequence shown below is from the reference sequence of NM_000596. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGA
  AATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATAT
  ATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGT
  TTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGA
  AACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCCTGCGTCTGTTTTTA
  AAGAGCATGGAAAAATACTGCCTAGAAAATGCAAAATGAAATAAGAGAGAGTAGTTTTTCAGCTAGTTTG
  AAGGAGGACGGTTAACTTGTATATTCCACCATTCACATTTGATGTACATGTGTAGGGAAAGTTAAAAGTG
  TTGATTACATAATCAAAGCTACCTGTGGTGATGTTGCCACCTGTTAAAATGTACACTGGATATGTTGTTA
  AACACGTGTCTATAATGGAAACATTTACAATAAATATTCTGCATGGAAATACTGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000596.2
• Summary: 'This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP N-terminal domain and a thyroglobulin type-I domain. The encoded protein, mainly expressed in the liver, circulates in the plasma and binds both insulin-like growth factors (IGFs) I and II, prolonging their half-lives and altering their interaction with cell surface receptors. This protein is important in cell migration and metabolism. Low levels of this protein may be associated with impaired glucose tolerance, vascular disease and hypertension in human patients. [provided by RefSeq, Aug 2017]'
• Locus ID: 3484