HDAC8 (NM_018486) Human 3' UTR Clone

CAT#: SC207801

3`UTR clone of histone deacetylase 8 (HDAC8) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HDAC8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HDAC8
Synonyms CDA07; CDLS5; HD8; HDACL1; KDAC8; MRXS6; RPD3; WTS
ACCN NM_018486
Insert Size 535
Sequence Data
>SC207801 3'UTR clone of NM_018486
The sequence shown below is from the reference sequence of NM_018486. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGGAATCTGAAGCATGTGGTCTAGTTGACAGAAAGAGATCAGGTTTCCAGAGCTGAGGAGTGGTGCCTAT
AATGAAGACAGCGTGTTTATGCAAGCAGTTTGTGGAATTTGTGACTGCAGGGAAAATTTGAAAGAAATTA
CTTCCTGAAAATTTCCAAGGGGCATCAAGTGGCAGCTGGCTTCCTGGGGTGAAGAGGCAGGCACCCCAGA
GTCCTCAACTGGACCTAGGGGAAGAAGGAGATATCCCACATTTAAAGTTCTTATTTAAAAAAACACACAC
ACACAAATGAAATTTTTAATCTTTGAAAATTATTTTTAAGCGAATTGGGGAGGGGAGTATTTTAATCATC
TTAAATGAAACAGATCAGAAGCTGGATGAGAGCAGTCACCAGTTTGTAGGGCAGGAGGCAGCTGACAGGC
AGGGTTTGGGCCTCAGGACCATCCAGGTGGAGCCCTGGGAGAGAGGGTACTGATCAGCAGACTGGGAGGT
GGGGAGAAGTCCGCTGGTGTTGTTTTAGTGTTATATATCTTTGGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018486.2
Summary Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Locus ID 55869

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.