Metabotropic Glutamate Receptor 8 (GRM8) (NM_001127323) Human 3' UTR Clone

CAT#: SC207825

3`UTR clone of glutamate receptor metabotropic 8 (GRM8) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRM8
• Synonyms: GLUR8; GPRC1H; mGlu8; MGLUR8
• ACCN: NM_001127323
• Insert Size: 604 bp
• Sequence Data:
  Insert Sequence

  >SC207825 3'UTR clone of NM_001127323
  The sequence shown below is from the reference sequence of NM_001127323. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTTCCGATGGTCAAGAGCGGGAGCACTTCCTAATAGATCTTCCTCTACCAAGACAACATATATCAGTTA
  CAGCAATCATTCAATCTGAAACAGGGAAATGGCACAATCTGAAGAGATGTGGTATATGATCTTAAATGAT
  GAACATGAGACCGCAAAAATTCACTCCTGGAGATCTCCGTAGACTACAATCAATCAAATCAATAGTCAGT
  CTTGTAAGGAACAAAAATTAGCCATGAGCCAAAAGTATCAATAAACGGGGAGTGAAGAAACCCGTTTTAT
  ACAATAAAACCAATGAGTGTCAAGCTAAAGTATTGCTTATTCATGAGCAGTTAAAACAAATCACAAAAGG
  AAAACTAATGTTAGCTCGTGAAAAAAAATGCTGTTGAAATAAATAATGTCTGATGTTATTCTTGTATTTT
  TCTGTGATTGTGAGAACTCCCGTTCCTGTCCCACATTGTTTAACTTGTATAAGACAATGAGTCTGTTTCT
  TGTAATGGCTGACCAGATTGAAGCCCTGGGTTGTGCTAAAAATAAATGCAATGATTGATGCATGCAATTT
  TTTATACAAATAATTTATTTCTAATAATAAAGGAATGTTTTGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127323.1
• Summary: 'L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 2918