Complement Component 6 (C6) (NM_001115131) Human 3' UTR Clone

CAT#: SC207839

3`UTR clone of complement component 6 (C6) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: C6
• Synonyms: complement component 6; OTTHUMP00000120010
• ACCN: NM_001115131
• Insert Size: 586 bp
• Sequence Data:
  Insert Sequence

  >SC207839 3'UTR clone of NM_001115131
  The sequence shown below is from the reference sequence of NM_001115131. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCCTGGAAAGTGTTTGGCCTAGCACAATTACTGCTAGGCCCAGCACAATGAACAGATTTACCATCCCG
  AAGAACCAACTCCTACAAATGAGAATTCTTGCACAAACAGCAGACTGGCATGCTCAAAGTTACTGACAAA
  AATTATTTTCTGTTAGTTTGAGATCATTATTCTCCCCTGACTCTCCTGTTTGGGCATGTCTTATTCAGTT
  CCAGCTCATGACGCCCTGTAGCATACCCCTAGGTACCAACTTCCACAGCAGTCTCGTAAATTCTCCTGTT
  CACATTGTACAAAAATAATGTGACTTCTGAGGCCCTTATGTAGCCTGTGACATTAAGCATTCTCGCAATT
  AGAAATAAGAATAAAACCCATAATTTTCTTCAATGAGTTAATAAACAGAAATCTCCAGAACCTCTGAAAC
  ACATTCTTGAAGCCCAGCTTTCATATCTTCATTCAACAAATAATTTCTGAGTGTGTATACAGGATGTCAA
  GTACTGACCAAAGTCCTGAGAACTCGGCAGATAATAAAACAGACAAAAGCCTTTGCCTTCATGAAGCATA
  CATTCATTCAGGGGTAGACACACAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001115131.1
• Summary: 'This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]'
• Locus ID: 729