hHR23A (RAD23A) (NM_005053) Human 3' UTR Clone

CAT#: SC207844

3`UTR clone of RAD23 homolog A (S. cerevisiae) (RAD23A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RAD23A
• Synonyms: HHR23A; HR23A
• ACCN: NM_005053
• Insert Size: 604 bp
• Sequence Data:
  Insert Sequence

  >SC207844 3'UTR clone of NM_005053
  The sequence shown below is from the reference sequence of NM_005053. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCCAACTTCCTCCTGAGTCAGAACTTTGATGACGAGTGATGCCAGGAAGCCAGGCCACCGAAGCCCCCA
  CCCTACCCTTATTCCATGAAAGTTTTATAAAAGAAAAAATATATATATATTCATGTTTATTTAAGAAATG
  GAAAAAAAAATCAAAAATCTTAAAAAAACAAGCAAACAGTCCAGCTTCCTGTCCTCCTAAAGTGGCCCCT
  GTTCCCATCTCCCGGGCCAGACAGCTGTCCCCCCGTCCTCCTCCCCAGCCCAGCCTGCTCAGAGAAGCTG
  GCAGGACTGGGAGGCGACAGATGGGCCCCTCTTGGCCTCTGTCCCAGCTCTCTGCAGCCAGACGGAAAGG
  CGGCTGCTTGCCTCTCCATCCTCCGAAAAACCCCTGAGGACCCCCCCCCATCCTCTTCTAGGATGAGGGG
  AAGCTGGAGCCCCAACTTTGATCCTCCATTGGAGTGGCCCAAATCTTTCCATCTAGGGCAAGTCCTGAAA
  GGCCCAAGGCCCCCTCCCCAGTCTGGCCTTGGCCTCCAGCCTGGAGAAGGGCTAACATCAGCTCATTGTC
  AAGGCCACCCCCACCCCAGAACAGAACCGTGTCTCTGATAAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005053.2
• Summary: 'The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in nucleotide excision repair. Proteins in this family have a modular domain structure consisting of an ubiquitin-like domain (UbL), ubiquitin-associated domain 1 (UbA1), XPC-binding domain and UbA2. The protein encoded by this gene plays an important role in nucleotide excision repair and also in delivery of polyubiquitinated proteins to the proteasome. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]'
• Locus ID: 5886