Thyroid Hormone Receptor alpha (THRA) (NM_199334) Human 3' UTR Clone

CAT#: SC207848

3`UTR clone of thyroid hormone receptor alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog avian) (THRA) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "THRA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol THRA
Synonyms AR7; c-ERBA-1; CHNG6; EAR7; ERB-T-1; ERBA; ERBA1; NR1A1; THRA1; THRA2
ACCN NM_199334
Insert Size 586 bp
Sequence Data
>SC207848 3'UTR clone of NM_199334
The sequence shown below is from the reference sequence of NM_199334. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGAGGTCTTTGAGGATCAGGAAGTCTAAAGCCTCAGGCGGCCAGAGGGTGTGCGGAGCTGGTGGGGAGGA
GCCTGGAGAGAAGGGGCAGAGCTGGGGGCTGAGGGAGACCCCCCCACACCCCTTCTCTCCTTCCTCTCGT
CCTTGGATAGATTCAGCTCCCACACACACACCCGCACTGCCCAGGTCCCTCCTCAGACCTCCAGCCCTGG
GACAGGGCAAACAACTGAACTTGCTATGGAAAGGACAGTGTGGGAGGCTGGGGGAGCTGTGTCCTGCAGT
TCCCAGGACCCCATCCTCTCAGAAGGTAGGGGAAGGGCGGGAGGATTGAGAAGGGACAAGCCACCTTGAC
CGTAGGGGAAGGAGGAATGTGGGCTGGGGGAAGATGCCCTCAACTCACCCCCTACACACACATGAGAGAG
AGCCCCCACCCAGTTCCTTGGCCTAGGTCTCCCCTCCAGGCTGAGGGCCTCTCTACTTCCCCAGATGCCT
GGGTGCAAAGAACGGCTTGGCTTGGCTCCTCCTCTGGAGGTTAAAATTTATAGTCATTCTAACTGCACTT
TGGAAACCAAGCAAGGGGAGAAGACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_199334.2
Summary 'The protein encoded by this gene is a nuclear hormone receptor for triiodothyronine. It is one of the several receptors for thyroid hormone, and has been shown to mediate the biological activities of thyroid hormone. Knockout studies in mice suggest that the different receptors, while having certain extent of redundancy, may mediate different functions of thyroid hormone. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
Locus ID 7067

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.