Natriuretic Peptide Receptor A (NPR1) (NM_000906) Human 3' UTR Clone

CAT#: SC207874

3`UTR clone of natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) (NPR1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NPR1
• Synonyms: ANPa; ANPRA; GUC2A; GUCY2A; NPRA
• ACCN: NM_000906
• Insert Size: 600 bp
• Sequence Data:
  Insert Sequence

  >SC207874 3'UTR clone of NM_000906
  The sequence shown below is from the reference sequence of NM_000906. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCTACTGGCTCCTTGGGGAGAGGGGGAGTAGCACCCGAGGCTGACCTGCCTCCTCTCCTATCCCTCC
  ACACCTCCCTACCCTGTGCCAGAAGCAACAGAGGTGCCAGGCCTCAGCCTCACCCACAGCAGCCCCATCG
  CCAAAGGATGGAAGTAATTTGAATAGCTCAGGTGTGCTGACCCCAGTGAAGACACCAGATAGGACCTCTG
  AGAGGGGACTGGCATGGGGGGATCTCAGAGCTTACAGGCTGAGCCAAGCCCACGGCCATGCACAGGGACA
  CTCACACAGGCACACGCACCTGCTCTCCACCTGGACTCAGGCCGGGCTGGGCTGTGGATTCCTGATCCCC
  TCCCCTCCCCATGCTCTCCTCCCTCAGCCTTGCTACCCTGTGACTTACTGGGAGGAGAAAGAGTCACCTG
  AAGGGGAACATGAAAAGAGACTAGGTGAAGAGAGGGCAGGGGAGCCCACATCTGGGGCTGGCCCACAATA
  CCTGCTCCCCCGACCCCCTCCACCCAGCAGTAGACACAGTGCACAGGGGAGAAGAGGGGTGGCGCAGAAG
  GGTTGGGGGCCTGTATGCCTTGCTTCTACCATGAGCAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000906.3
• Summary: 'Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]'
• Locus ID: 4881