Acinus (ACIN1) (NM_001164814) Human 3' UTR Clone

CAT#: SC207875

3`UTR clone of apoptotic chromatin condensation inducer 1 (ACIN1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACIN1
• Synonyms: ACINUS; ACN; fSAP152
• ACCN: NM_001164814
• Insert Size: 599
• Sequence Data:
  Insert Sequence

  >SC207875 3'UTR clone of NM_001164814
  The sequence shown below is from the reference sequence of NM_001164814. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTCGGAGCACACCTGTGCGGGACCGGGGTGGGCGCCGCTAGCTGGGAAAACACTAGAGCTGCAGGTAC
  CAGCCACTCGGCCCCAGGGGGTTATGGCCACAGAGGGATAGGCACAGTCTCCACCACCCTGGAGCCAAGG
  GTCTTTCACATCACCTATCCCTACATACATACCAAATGGAAAAGTGGCCATCCTTTTCCCCCCAAACACA
  CCCCCTTAACCTATCTCTTGGGACTTAGCCCGACCCTCCCTCTCATTTCCCATTAAGTCTGAGAGGCAAG
  AGCTAGGTTAGGCAAGGAGGTGGTTGGCCAGAGATGGGGAACAGCCAGGTGCCCCAGTCCTCTGATTTTT
  CCTCCATCCTGCTTACCACCTCCCTGGGTACTTACAGCCTTCTCTTGGGAACAGCCGGGGCCAGGACTGG
  GTCACCTATGAGCTGAATCAGCATCTCCTCCTGAGTCCCAGGGCCCCTGCAGTTCCCAGTCTCTTCTGTC
  CTGCAGCCCTTGCCTCTTTCCCACAGGTTCCACTTTATATCCACCTTTTCCTTTTGTTCAATTTTTATTT
  TTATTTTTTTTATTATTAAATGATGTGGTCTATGGAAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001164814.1
• Summary: Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
• Locus ID: 22985