HMGCL (NM_000191) Human 3' UTR Clone

CAT#: SC207882

3`UTR clone of 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase (HMGCL) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HMGCL
• Synonyms: HL
• ACCN: NM_000191
• Insert Size: 618 bp
• Sequence Data:
  Insert Sequence

  >SC207882 3'UTR clone of NM_000191
  The sequence shown below is from the reference sequence of NM_000191. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCAAAGTGGCTCAGGCTACCTGTAAACTCTGAGCCCCTTGCCCACCTGAAGCCCTGGGGATGATGTGGA
  AATAGGGGCACACACAGATGATTCATGGATGGGGACATGGAAATGAGAATAGGTTAAATGGTGCAGGTAC
  CTCATAGCCAGCTCTACACAGAGGTCTCTCCTGGCAGAAAGCAGGCGAAGGGCAGGAGGAGCTGCTTGGC
  AGAAGGACCTCCTGCCCAGACCTGAGGAGTGAGAGGCTTTGAGGGCTGAAGTCTCCCTTTGTTACGGACC
  CTGGCCCAGGAGTTGAATGCCTGAGGACGTGTGGGAACCCCGTTCCCTACTTAGCATGATCCTTGAGTCT
  CCTCTCTGGATGGAATCCGCGAGCTGGCCACCTGGCCACCCTCTACACGGCTCCACCCTGCCATGGCCGT
  GGGGCCCTTGCTCTCTGACTTCTCAGGACACAGGTCATGGAGGTTCTTCCCAAGCTGGCAGAGGCCATTT
  GTGGAAAGTGGAGAGCTACGTGGTGGCCGTCTGCCAACTCCAGCATCTCTGGAAAATCTCCACGCTGAAT
  GTGATTTTTGAAAACAGCTTATGTAATTAAAGGTTGAATGGCACATCATAATTCCAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000191.2
• Summary: 'The protein encoded by this gene belongs to the HMG-CoA lyase family. It is a mitochondrial enzyme that catalyzes the final step of leucine degradation and plays a key role in ketone body formation. Mutations in this gene are associated with HMG-CoA lyase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]'
• Locus ID: 3155