Calreticulin (CALR) (NM_004343) Human 3' UTR Clone

CAT#: SC207887

3`UTR clone of calreticulin (CALR) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CALR"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CALR
Synonyms cC1qR; CRT; HEL-S-99n; RO; SSA
ACCN NM_004343
Insert Size 597 bp
Sequence Data
>SC207887 3'UTR clone of NM_004343
The sequence shown below is from the reference sequence of NM_004343. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAGAGAGGCCTGCCTCCAGGGCTGGACTG
AGGCCTGAGCGCTCCTGCCGCAGAGCTGGCCGCGCCAAATAATGTCTCTGTGAGACTCGAGAACTTTCAT
TTTTTTCCAGGCTGGTTCGGATTTGGGGTGGATTTTGGTTTTGTTCCCCTCCTCCACTCTCCCCCACCCC
CTCCCCGCCCTTTTTTTTTTTTTTTTTTAAACTGGTATTTTATCTTTGATTCTCCTTCAGCCCTCACCCC
TGGTTCTCATCTTTCTTGATCAACATCTTTTCTTGCCTCTGTCCCCTTCTCTCATCTCTTAGCTCCCCTC
CAACCTGGGGGGCAGTGGTGTGGAGAAGCCACAGGCCTGAGATTTCATCTGCTCTCCTTCCTGGAGCCCA
GAGGAGGGCAGCAGAAGGGGGTGGTGTCTCCAACCCCCCAGCACTGAGGAAGAACGGGGCTCTTCTCATT
TCACCCCTCCCTTTCTCCCCTGCCCCCAGGACTGGGCCACTTCTGGGTGGGGCAGTGGGTCCCAGATTGG
CTCACACTGAGAATGTAAGAACTACAAACAAAATTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004343.3
Summary 'Calreticulin is a highly conserved chaperone protein which resides primarily in the endoplasmic reticulum, and is involved in a variety of cellular processes, among them, cell adhesion. Additionally, it functions in protein folding quality control and calcium homeostasis. Calreticulin is also found in the nucleus, suggesting that it may have a role in transcription regulation. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin. Recurrent mutations in calreticulin have been linked to various neoplasms, including the myeloproliferative type.[provided by RefSeq, May 2020]'
Locus ID 811

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.