SUOX (NM_000456) Human 3' UTR Clone

CAT#: SC207944

3`UTR clone of sulfite oxidase (SUOX) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SUOX"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SUOX
ACCN NM_000456
Insert Size 531 bp
Sequence Data
>SC207944 3'UTR clone of NM_000456
The sequence shown below is from the reference sequence of NM_000456. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCAGCAATGCCTGGCATCGTGTCCATGTCTATGTCTCCCCATGAGCATGGAAAGGAGCCACCTCCACCC
CTTTCCCCACCCATTAGCCTCACTGCTTCAGAAAAATCTTTCCCACCTTTCAACTTCTTGGATCACAACT
CTGGCCTTCCTAAGCCATACCCAAGTACACATATAGCACATTTCACCCAAGGACCTTCCCTCTTTGGACA
CTATGTTACATACCCCTCTTGGCCTTTGAACCTGTGCCAGGAAGTGTGAGCTGTTACAGCAAGGGGCTAG
AAGTGAAAAAAGTAATTCTGGAGACAAGCACTATTTTCTCTTCCTACCCCACCTCCATTTCTAATGCCTA
CTGCCATCAAGGCCTTGTTTTGCTTTTCTTTTTGGATTGTTCAGAGAAATGTGTGTGGCATGTGTAAGAA
AAGTGTATATACTATCTTATACTACCTCTCCAGGTTGCCAGAGAGTTGCGAGGAGAGCAAGGGGCACAAC
CGTCTCCCTTTATAGTTCTACTTTTCTAATAAATAGTCTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000456.2
Summary 'Sulfite oxidase is a homodimeric protein localized to the intermembrane space of mitochondria. Each subunit contains a heme domain and a molybdopterin-binding domain. The enzyme catalyzes the oxidation of sulfite to sulfate, the final reaction in the oxidative degradation of the sulfur amino acids cysteine and methionine. Sulfite oxidase deficiency results in neurological abnormalities which are often fatal at an early age. Alternative splicing results in multiple transcript variants encoding identical proteins. [provided by RefSeq, Jul 2008]'
Locus ID 6821

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.