IKK gamma (IKBKG) (NM_001099856) Human 3' UTR Clone

CAT#: SC207965

3`UTR clone of inhibitor of kappa light polypeptide gene enhancer in B-cells kinase gamma (IKBKG) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IKBKG
• Synonyms: AMCBX1; EDAID1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP; IP1; IP2; IPD2; NEMO; ZC2HC9
• ACCN: NM_001099856
• Insert Size: 598
• Sequence Data:
  Insert Sequence

  >SC207965 3'UTR clone of NM_001099856
  The sequence shown below is from the reference sequence of NM_001099856. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGAGTGCATTGAGTAGGGCCGGCCAGTGCAAGGCCACTGCCTGCCGAGGACGTGCCCGGGACCGTGCA
  GTCTGCGCTTTCCTCTCCCGCCTGCCTAGCCCAGGATGAAGGGCTGGGTGGCCACAACTGGGATGCCACC
  TGGAGCCCCACCCAGGAGCTGGCCGCGGCACCTTACGCTTCAGCTGTTGATCCGCTGGTCCCCTCTTTTG
  GGGTAGATGCGGCCCCGATCAGGCCTGACTCGCTGCTCTTTTTGTTCCCTTCTGTCTGCTCGAACCACTT
  GCCTCGGGCTAATCCCTCCCTCTTCCTCCACCCGGCACTGGGGAAGTCAAGAATGGGGCCTGGGGCTCTC
  AGGGAGAACTGCTTCCCCTGGCAGAGCTGGGTGGCAGCTCTTCCTCCCACCGGACACCGACCCGCCCGCT
  GCTGTGCCCTGGGAGTGCTGCCCTCTTACCATGCACACGGGTGCTCTCCTTTTGGGCTGCATGCTATTCC
  ATTTTGCAGCCAGACCGATGTGTATTTAACCAGTCACTATTGATGGACATTTGGGTTGTTTCCCATCTTT
  TTGTTACCATAAATAATGGCATAGTAAAAATCCTTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001099856.2
• Summary: This gene encodes the regulatory subunit of the inhibitor of kappaB kinase (IKK) complex, which activates NF-kappaB resulting in activation of genes involved in inflammation, immunity, cell survival, and other pathways. Mutations in this gene result in incontinentia pigmenti, hypohidrotic ectodermal dysplasia, and several other types of immunodeficiencies. A pseudogene highly similar to this locus is located in an adjacent region of the X chromosome. [provided by RefSeq, Mar 2016]
• Locus ID: 8517