TIAM2 (NM_012454) Human 3' UTR Clone

CAT#: SC207969

3`UTR clone of T-cell lymphoma invasion and metastasis 2 (TIAM2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TIAM2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TIAM2
Synonyms STEF; TIAM-2
ACCN NM_012454
Insert Size 611
Sequence Data
>SC207969 3'UTR clone of NM_012454
The sequence shown below is from the reference sequence of NM_012454. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGAAACAGAGAGCCACGGAAAATCATAGTATGATTCAATCCAGATATGGGTTAAATTCCTCATTTTACTT
TTAAACTGGTGGTAAAGTGGAAATTGCAAAAAAAAAAAAAAAAAAAAACTGTTCATTCCTGGGTTTTGTG
CAGTATACATTTTCCCACAAAATGGTTGTAAAGATTTAAGTTATTTTAATTTATTGTGGATCAGAAACCT
AGATGAAACTGGTCAGAATCTGTAAATTACTTAGTTTATATCCACTTTGAGCAGGTATCAAATGATTTAG
GATCCTTAAAATTACATTCTAATAATTAAGTTATGTGGAAAAAGTAAGGCTGGGGAAGTCGTGATTAATA
GTTTTCAAAGGGCCATTTTTTAAAATCCTCTGGGCATTTTCTTTCAGCTGTTTGTTAGTTTTTGCTTTAT
TTAAAGCATATTTAAGTTATTTTAATGTGGTTTAGGGGCAAAATGTGCAGATACTTCATTTTTGTAAGAT
AGATTGTAATAGATGCTGTTTATACTAAACATGTCATAACTATCTATACAGTATATATTAAAAGAAAGCT
TGTACTGTATCTTATTTGATGATATTTATTTTCTCTGCCAAGCTGTATAGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012454.3
Summary This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 26230

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.