MAN1B1 (NM_016219) Human 3' UTR Clone

CAT#: SC207970

3`UTR clone of mannosidase alpha class 1B member 1 (MAN1B1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAN1B1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MAN1B1
Synonyms ERMAN1; ERManI; MANA-ER; MRT15
ACCN NM_016219
Insert Size 615
Sequence Data
>SC207970 3'UTR clone of NM_016219
The sequence shown below is from the reference sequence of NM_016219. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTTCAACACCGAAGCCCACCCTCTGCCTATCTGGACCCCTGCCTAGGGTGGATGGCTGCTGGTGTGGGGA
CTTCGGGTGGGCAGAGGCACCTTGCTGGGTCTGTGGCATTTTCCAAGGGCCCACGTAGCACCGGCAACCG
CCAAGTGGCCCAGGCTCTGAACTGGCTCTGGGCTCCTCCTCGTCTCTGCTTTAATCAGGACACCGTGAGG
ACAAGTGAGGCCGTCAGTCTTGGTGTGATGCGGGGTGGGCTGGGCCGCTGGAGCCTCCGCCTGCTTCCTC
CAGAAGACACGAATCATGACTCACGATTGCTGAAGCCTGAGCAGGTCTCTGTGGGCCGACCAGAGGGGGG
CTTCGAGGTGGTCCCTGGTACTGGGGTGACCGAGTGGACAGCCCAGGGTGCAGCTCTGCCCGGGCTCGTG
AAGCCTCAGATGTCCCCAATCCAAGGGTCTGGAGGGGCTGCCGTGACTCCAGAGGCCTGAGGCTCCAGGG
CTGGCTCTGGTGTTTACAAGCTGGACTCAGGGATCCTCCTGGCCGCCCCGCAGGGGGCTTGGAGGGCTGG
ACGGCAAGTCCGTCTAGCTCACGGGCCCCTCCAGTGGAATGGGTCTTTTCGGTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016219.3
Summary This gene encodes an enzyme belonging to the glycosyl hydrolase 47 family. This enzyme functions in N-glycan biosynthesis, and is a class I alpha-1,2-mannosidase that specifically converts Man9GlcNAc to Man8GlcNAc isomer B. It is required for N-glycan trimming to Man5-6GlcNAc2 in the endoplasmic-reticulum-associated degradation pathway. Mutations in this gene cause autosomal-recessive intellectual disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Dec 2011]
Locus ID 11253

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.