Macro H2A.2 (H2AFY2) (NM_018649) Human 3' UTR Clone

CAT#: SC207974

3`UTR clone of H2A histone family member Y2 (H2AFY2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: H2AFY2
• Synonyms: macroH2A2
• ACCN: NM_018649
• Insert Size: 645
• Sequence Data:
  Insert Sequence

  >SC207974 3'UTR clone of NM_018649
  The sequence shown below is from the reference sequence of NM_018649. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCGGCATCTACGTGCAGGAGATGGCCAAGCTCGACGCCAAGTAGCCGCCGCACTTTCCAGCAGGGATCG
  GAGGACGACCCGAGTCCCAAGAGTGGGGTTTTGCTTTTTAAAAGGAGAGAGGAGGGGTGATGGCAGGGGA
  GTGGAGGGTGGCCGGGCAGGTCCTGCCGGCGCAGGGAGCCCTCTGCCCTTCACACTCTCCTCCAAAAGAG
  CCTCCATCTGTAAGGAAGCAGGTCTCCGCGAGGGGTTTCTTTCCATGTGTTTTCCTCCTGTTGTTTTAGA
  ACTTTTTTAAAAAAACAGACCTCGTTTTAGATTTATAGCATTGACTTTTACACACATTCACACAAGAAAA
  AAATCCTTTCAAAATTCTTAAATCTTCTGTTCCTCCTTTTTCCAAGGGAAGAGGGCAAAAAGTGGCCTGG
  GCTCTGTTGGTGTGCGTGTTCCGTGGCGGAGAGAAGAAAATGGGAAAGACATCTCACTGGTGCTTTTCTC
  TTTTGTTTTAGTGCCCCCCGCCCCCATCCCTATAATATCTGTAACTACTCCTAAAAAGGTTTTGATTCAG
  GCTTTTTTTTGGTTTCATTTTGTTTTTTTAAGAAAAAGAAAATGAAAGGAAAAAAATAAAAGATCCAGTG
  TCTTTCTTACAACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018649.2
• Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and may participate in stable X chromosome inactivation. [provided by RefSeq, Oct 2015]
• Locus ID: 55506