PON1 (NM_000446) Human 3' UTR Clone

CAT#: SC207986

3`UTR clone of paraoxonase 1 (PON1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PON1
• Synonyms: ESA; MVCD5; PON
• ACCN: NM_000446
• Insert Size: 622 bp
• Sequence Data:
  Insert Sequence

  >SC207986 3'UTR clone of NM_000446
  The sequence shown below is from the reference sequence of NM_000446. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGATTGGCACAGTGTTTCACAAAGCTCTTTACTGTGAGCTCTAACAGACCGATTTGCACCCATGCCAT
  AGAAACTGAGGCCATTATTTCAACCGCTTGCCATATTCCGAGGACCCAGTGTTCTTAGCTGAACAATGAA
  TGCTGACCCTAAATGTGGACATCATGAAGCATCAAAGCACTGTTTAACTGGGAGTGATATGATGTGTAGG
  GCTTTTTTTTGAGAATACACTATCAAATCAGTCTTGGAATACTTGAAAACCTCATTTACCATAAAAATCC
  TTCTCACTAAAATGGATAAATCAGTTATGTCAATTGTCAGATATTAAATAACAGTGTGTGACCCCAAAAG
  TACTTACCCTAAAACATGTGTTGCCTGGAAGCACATGTGTGTATCGCTGCCTTGCCATGTCTTGTTCAGA
  AGACACAGGGGAGCAGGGTTAGCTCACGTGTCTTTAGAACTCCAGTACTCACCCAGGGACTCCAGTTCAC
  AGGCCAGAAAACATATGCATTATGAAGTTCCCCTCTACTCCATGCACATAGTAAGTCTGACTATGGCAGT
  CAGACTTACTTACTCCCATTTTCCCTTCGATATATGACTTTTTCTCAGTAAATATTAACCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000446.5
• Summary: 'This gene encodes a member of the paraoxonase family of enzymes and exhibits lactonase and ester hydrolase activity. Following synthesis in the kidney and liver, the enzyme is secreted into the circulation, where it binds to high density lipoprotein (HDL) particles and hydrolyzes thiolactones and xenobiotics, including paraoxon, a metabolite of the insecticide parathion. Polymorphisms in this gene may be associated with coronary artery disease and diabetic retinopathy. The gene is found in a cluster of three related paraoxonase genes on chromosome 7. [provided by RefSeq, Aug 2017]'
• Locus ID: 5444