CEBP Beta (CEBPB) (NM_005194) Human 3' UTR Clone

CAT#: SC207991

3`UTR clone of CCAAT/enhancer binding protein (C/EBP) beta (CEBPB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CEBPB
• Synonyms: C/EBP-beta; IL6DBP; NF-IL6; TCF5
• ACCN: NM_005194
• Insert Size: 632 bp
• Sequence Data:
  Insert Sequence

  >SC207991 3'UTR clone of NM_005194
  The sequence shown below is from the reference sequence of NM_005194. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGCTCGCCTCCTCCGGCCACTGCTAGCGCGGCCCCCGCGCGCGTCCCCCTGCCGGCCGGGGCTGAGAC
  TCCGGGGAGCGCCCGCGCCCGCGCCCTCGCCCCCGCCCCCGGCGGCGCCGGCAAAACTTTGGCACTGGGG
  CACTTGGCAGCGCGGGGAGCCCGTCGGTAATTTTAATATTTTATTATATATATATATCTATATTTTTGTC
  CAAACCAACCGCACATGCAGATGGGGCTCCCGCCCGTGGTGTTATTTAAAGAAGAAACGTCTATGTGTAC
  AGATGAATGATAAACTCTCTGCTTCTCCCTCTGCCCCTCTCCAGGCGCCGGCGGGCGGGCCGGTTTCGAA
  GTTGATGCAATCGGTTTAAACATGGCTGAACGCGTGTGTACACGGGACTGACGCAACCCACGTGTAACTG
  TCAGCCGGGCCCTGAGTAATCGCTTAAAGATGTTCCTACGGGCTTGTTGCTGTTGATGTTTTGTTTTGTT
  TTGTTTTTTGGTCTTTTTTTGTATTATAAAAAATAATCTATTTCTATGAGAAAAGAGGCGTCTGTATATT
  TTGGGAATCTTTTCCGTTTCAAGCATTAAGAACACTTTTAATAAACTTTTTTTTGAGAATGGTTACAAAG
  CC
  
  CGGACCGTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-RsrII
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005194.2
• Summary: 'This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain. The encoded protein functions as a homodimer but can also form heterodimers with CCAAT/enhancer-binding proteins alpha, delta, and gamma. Activity of this protein is important in the regulation of genes involved in immune and inflammatory responses, among other processes. The use of alternative in-frame AUG start codons results in multiple protein isoforms, each with distinct biological functions. [provided by RefSeq, Oct 2013]'
• Locus ID: 1051