MCM3 (NM_002388) Human 3' UTR Clone

CAT#: SC208013

3`UTR clone of minichromosome maintenance complex component 3 (MCM3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MCM3
• Synonyms: HCC5; P1-MCM3; P1.h; RLFB
• ACCN: NM_002388
• Insert Size: 591 bp
• Sequence Data:
  Insert Sequence

  >SC208013 3'UTR clone of NM_002388
  The sequence shown below is from the reference sequence of NM_002388. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGTGTCTGAGGGCATCATCTTCCTCATCTGAGGAGGCCTCGTCTCTGAACTTGGGTTGTGCCGAGAGA
  GTTTGTTCTGTGTTTCCCACCCTCTCCCTGACCCAAGTCTTTGCCTCTACTCCCTTAACAGTGTTGAATT
  CAACTGAAGGCGAGGAATGTTGGTGATGAAGCTGAGTTCAGGACTCGGTGGACCCTTTGGGAATGGGTCA
  TGAAAGCTGCCATGGGGTGAGGAAAGAGGAGACAGTGGGAGAGGACAATGACTATTGCATCTTCATTGCA
  AAAGCACTGGCTCATCCGCCCTACTTCCCATCCCACACAAACCCAATTGTAAATAACATATGACTTCTGA
  GTACTTTTGGGGGCACAACTGTTTTCTGTTTGCTGTTTTTTTGTTTTGTTTTTTTTCTCCAGAGCACTTT
  GGTCTAGACTAGGCTTTGGGTGGTTCCAATTGGTGGAGAGAAGCTCTGAGGCACGTCATGCAGGTCAAGA
  AAGCTTTCTTTGCAGTAGCACCAGTTAAGGTGAATATGTATTGTATCACAAAACAAACCCAATATCCAGA
  TGAATATCCGAGATGTTGAATAAACTTAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002388.3
• Summary: 'The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2018]'
• Locus ID: 4172