p19 INK4d (CDKN2D) (NM_079421) Human 3' UTR Clone

CAT#: SC208106

3`UTR clone of cyclin-dependent kinase inhibitor 2D (p19 inhibits CDK4) (CDKN2D) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CDKN2D"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CDKN2D
Synonyms INK4D; p19; p19-INK4D
ACCN NM_079421
Insert Size 634
Sequence Data
>SC208106 3'UTR clone of NM_079421
The sequence shown below is from the reference sequence of NM_079421. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACCTCGTGGACATCCTGCAGGGCCACATGGTGGCCCCGCTGTGATCTGGGGTCACCCTCTCCAGCAAGA
GAACCCCGTGGGGTTATGTATCAGAAGAGAGGGGAAGAAACACTTTCTCTTCTTGTTTCTCCTGCCCACT
GCTGCAGTAGGGGAGGAGCACAGTTTGTGGCTTATAGGTGTTGGTTTTGGGGGTGTGAGTGTTTGGGGGA
CGTTTCTCATTTGTTTTTCTCACTCCTTTTGGTGTGTTGGACAGAGAAGGGCTCCTGCAGGCCACAGCCA
CCTAAACGGTTCAGTTTCTTCTGCGCCTCAGGCTGCTGGGGCCTCAGACGAGACCCAAGGGCAGAGCATT
TAAGAGTGAAGTCATGACCTCCAGGGAGCCTAGAAGCTGGTGGCCTTGGCCGGCTGTGCTCAGAGACCTG
AAGTGTGCACGTTGCTTCAGGCATGGGGGGTGGGGGGAGCGTCCCAAATCAATAAGAAGGTAGAATGAGT
TATGAGTTATTCATATTCTGTTGGAAGCTTGTTTTCCAGTCTCTTGTACAGCGTTTTAAAAGAAATGGAT
TCTATTTATTATGCTTTATTGGAAAAAATGTTGTAATAATTTAATGTTTTTACCCATTAAATTAAGACTT
GTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_079421.2
Summary The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
Locus ID 1032

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.