PDE1C (NM_005020) Human 3' UTR Clone

CAT#: SC208107

3`UTR clone of phosphodiesterase 1C calmodulin-dependent 70kDa (PDE1C) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PDE1C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PDE1C
Synonyms cam-PDE 1C; DFNA74; hCam-3; Hcam3
ACCN NM_005020
Insert Size 614 bp
Sequence Data
>SC208107 3'UTR clone of NM_005020
The sequence shown below is from the reference sequence of NM_005020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAAACAGATGATTCACAAGAGTAAAAAAGACCTCATAGACAATAAAAGAGGCTGCCAGTGTCTTGCATC
ATTCTAGCTGAGCTTCTTCATTCTCCTTCTTCTCCTTCTTCCACAAAGACCCATATCTGGAGAAGGTGTA
CAACTTTCAAACACAAGCCCCCCACCCCCTGACCCTTGGCCTTCCCTCACACCATCTCCTTCCAGGGGAT
GAATCTTTGGGGGTTGGTTTGAGGTCTTAGAACTCTGGGGGATATTCCCCTGAGCAAAACAAACAACGTG
AGATTTTTACTCAAACAGAAACAAAACATGAAGGGGCATCCTCAAAATCCTTTGCTAATGACCTGGCTTT
CAAGGCATCTGTCTGGCCTGATGAGAATGGACATCCTGGATATGCTGGGAGAGGCCTGAAAAAAGCCACA
CACACAGTAATTGCCATTTTATGACTGTCAATGCCGTTACTTTAAATGTTGTCATTTTTGCACTGGCTAC
TGATGATACAGCCATGCTGACATTCATCACCGCAAAGATGATGATTCCAGTCTCTGGTTCCTTTCCTGAG
TCAGGAACATTTGTTTTCTCCAATTTCCTTTCAGACTTAAAATTGTTCTTATGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005020.1
Summary 'This gene encodes an enzyme that belongs to the 3'5'-cyclic nucleotide phosphodiesterase family. Members of this family catalyze hydrolysis of the cyclic nucleotides, cyclic adenosine monophosphate and cyclic guanosine monophosphate, to the corresponding nucleoside 5'-monophosphates. The enzyme encoded by this gene regulates proliferation and migration of vascular smooth muscle cells, and neointimal hyperplasia. This enzyme also plays a role in pathological vascular remodeling by regulating the stability of growth factor receptors, such as PDGF-receptor-beta. [provided by RefSeq, Jul 2016]'
Locus ID 5137

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.