Heme oxygenase 2 (HMOX2) (NM_001127204) Human 3' UTR Clone

CAT#: SC208120

3`UTR clone of heme oxygenase (decycling) 2 (HMOX2) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HMOX2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HMOX2
Synonyms HO-2
ACCN NM_001127204
Insert Size 600 bp
Sequence Data
>SC208120 3'UTR clone of NM_001127204
The sequence shown below is from the reference sequence of NM_001127204. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTAGCTGCTGGACTCTTGGCCTGGTACTACATGTGAAGCACCCATCATGCCACACCGGTACCCTCCTCC
CGACTGACCACTGGCCTACCCCTTTCTCCAGCCCTGACTAAACTACCACCTCAGGTGACTTTTTAAAAAA
TGCTGGGTTTAAGAAAGGCAACCAATAAAAGCCAGATGCTAGAGCCTCTGCCTGACAGCATCCTCTCTAT
GGGCCATATTCCGCACTGGGCACAGGCCGTCACCCTGGGAGCAGTCGGCACAGTGCAGCAAGCCTGGCCC
CCGACCCAGCTCTACTCCAGGCTTCCACACTTCTGGGCCCTAGGCTGCTTCCGGTAGTCCCTGTTTTTGC
AGTACATGGGTGACTATCTCCCCTGTTGGAGGTGAGTGGCCTGTAAGTCCAAGCTGTGCGAGGGGGCCTT
GCTGGATGCTGCTGTACAACTTCTGGGCCTCTCTTGGACCCTGGGAGTGAGGGTGGGTGTGGGTGGAAGC
CTCAGAGGCCTTGGGAGCTCATCCCTCTCACCCAGAATCCCTCTAACCCCTTGGGTGCGGTTTGCTCAGC
CCCAGCTTATCTCCTCCTCCGCGCTGTGTAAATGCTCCAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001127204.1
Summary 'Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]'
Locus ID 3163

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.