Heme oxygenase 2 (HMOX2) (NM_001127205) Human 3' UTR Clone

CAT#: SC208121

3`UTR clone of heme oxygenase (decycling) 2 (HMOX2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HMOX2
• Synonyms: HO-2
• ACCN: NM_001127205
• Insert Size: 600 bp
• Sequence Data:
  Insert Sequence

  >SC208121 3'UTR clone of NM_001127205
  The sequence shown below is from the reference sequence of NM_001127205. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTAGCTGCTGGACTCTTGGCCTGGTACTACATGTGAAGCACCCATCATGCCACACCGGTACCCTCCTCC
  CGACTGACCACTGGCCTACCCCTTTCTCCAGCCCTGACTAAACTACCACCTCAGGTGACTTTTTAAAAAA
  TGCTGGGTTTAAGAAAGGCAACCAATAAAAGCCAGATGCTAGAGCCTCTGCCTGACAGCATCCTCTCTAT
  GGGCCATATTCCGCACTGGGCACAGGCCGTCACCCTGGGAGCAGTCGGCACAGTGCAGCAAGCCTGGCCC
  CCGACCCAGCTCTACTCCAGGCTTCCACACTTCTGGGCCCTAGGCTGCTTCCGGTAGTCCCTGTTTTTGC
  AGTACATGGGTGACTATCTCCCCTGTTGGAGGTGAGTGGCCTGTAAGTCCAAGCTGTGCGAGGGGGCCTT
  GCTGGATGCTGCTGTACAACTTCTGGGCCTCTCTTGGACCCTGGGAGTGAGGGTGGGTGTGGGTGGAAGC
  CTCAGAGGCCTTGGGAGCTCATCCCTCTCACCCAGAATCCCTCTAACCCCTTGGGTGCGGTTTGCTCAGC
  CCCAGCTTATCTCCTCCTCCGCGCTGTGTAAATGCTCCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127205.1
• Summary: 'Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]'
• Locus ID: 3163