Her2 (ERBB2) (NM_001005862) Human 3' UTR Clone

CAT#: SC208187

3`UTR clone of v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 neuro/glioblastoma derived oncogene homolog (avian) (ERBB2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ERBB2
• Synonyms: CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1
• ACCN: NM_001005862
• Insert Size: 628 bp
• Sequence Data:
  Insert Sequence

  >SC208187 3'UTR clone of NM_001005862
  The sequence shown below is from the reference sequence of NM_001005862. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGAACCCAGAGTACCTGGGTCTGGACGTGCCAGTGTGAACCAGAAGGCCAAGTCCGCAGAAGCCCTGA
  TGTGTCCTCAGGGAGCAGGGAAGGCCTGACTTCTGCTGGCATCAAGAGGTGGGAGGGCCCTCCGACCACT
  TCCAGGGGAACCTGCCATGCCAGGAACCTGTCCTAAGGAACCTTCCTTCCTGCTTGAGTTCCCAGATGGC
  TGGAAGGGGTCCAGCCTCGTTGGAAGAGGAACAGCACTGGGGAGTCTTTGTGGATTCTGAGGCCCTGCCC
  AATGAGACTCTAGGGTCCAGTGGATGCCACAGCCCAGCTTGGCCCTTTCCTTCCAGATCCTGGGTACTGA
  AAGCCTTAGGGAAGCTGGCCTGAGAGGGGAAGCGGCCCTAAGGGAGTGTCTAAGAACAAAAGCGACCCAT
  TCAGAGACTGTCCCTGAAACCTAGTACTGCCCCCCATGAGGAAGGAACAGCAATGGTGTCAGTATCCAGG
  CTTTGTACAGAGTGCTTTTCTGTTTAGTTTTTACTTTTTTTGTTTTGTTTTTTTAAAGATGAAATAAAGA
  CCCAGGGGGAGAATGGGTGTTGTATGGGGAGGCAAGTGTGGGGGGTCCTTCTCCACACCCACTTTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001005862.1
• Summary: 'This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]'
• Locus ID: 2064