PTPRN (NM_002846) Human 3' UTR Clone

CAT#: SC208205

3`UTR clone of protein tyrosine phosphatase receptor type N (PTPRN) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PTPRN
• Synonyms: IA-2; IA-2/PTP; IA2; ICA512; R-PTP-N
• ACCN: NM_002846
• Insert Size: 638 bp
• Sequence Data:
  Insert Sequence

  >SC208205 3'UTR clone of NM_002846
  The sequence shown below is from the reference sequence of NM_002846. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGGAAGTGAATGCCATCCTCAAGGCCCTGCCCCAGTGAGACCCTGGGGCCCCTTGGCGGGCAGCCCAGC
  CTCTGTCCCTCTTTGCCTGTGTGAGCATCTCTGTGTACCCACTCCTCACTGCCCCACCAGCCACCTCTTG
  GGCATGCTCAGCCCTTCCTAGAAGAGTCAGGAAGGGAAAGCCAGAAGGGGCACGCCTGCCCAGCCTCGCA
  TGCCAGAGCCTGGGGCATCCCAGAGCCCAGGGCATCCCATGGGGGTGCTGCAGCCAGGAGGAGAGGAAAG
  GACATGGGTAGCAATTCTACCCAGAGCCTTCTCCTGCCTACATTCCCTGGCCTGGCTCTCCTGTAGCTCT
  CCTGGGGTTCTGGGAGTTCCCTGAACATCTGTGTGTGTCCCCCTATGCTCCAGTATGGAAGAATGGGGTG
  GAGGGTCGCCACACCCGGCTCCCCCTGCTTCTCAGCCCCGGGCCTGCCTCTGACTCACACTTGGGCGCTC
  TGCCCTCCCTGGCCTCACGCCCAGCCTCCTCCCACCACCCTCCCACCATGCGCTGCTCAACCTCTCTCCT
  TCTGGCGCAAGAGAACATTTCTAGAAAAAACTACTTTTGTACCAGTGTGAATAAAGTTAGTGTGTTGTCT
  GTGCAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002846.2
• Summary: 'The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]'
• Locus ID: 5798