APRIL (TNFSF13) (NM_172088) Human 3' UTR Clone

CAT#: SC208206

3`UTR clone of tumor necrosis factor (ligand) superfamily member 13 (TNFSF13) transcript variant gamma for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TNFSF13
• Synonyms: APRIL; CD256; TALL-2; TALL2; TNLG7B; TRDL-1; UNQ383/PRO715; ZTNF2
• ACCN: NM_172088
• Insert Size: 605
• Sequence Data:
  Insert Sequence

  >SC208206 3'UTR clone of NM_172088
  The sequence shown below is from the reference sequence of NM_172088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCTCCACATGGAACCTTCCTGGGACTTTGATTTTACGGATATCTTGCTTCTGTTCCCCATGGAGCTCCG
  AATTCTTGCGTGTGTGTAGATGAGGGGCGGGGGACGGGCGCCAGGCATTGTCCAGACCTGGTCGGGGCCC
  ACTGGAAGCATCCAGAACAGCACCACCATCTAGCGGCCGCTCGAGGGAAGCACCCGCCGGTTGGCCGAAG
  TCCACGAAGCCGCCCTCTGCTAGGGAAAACCCCTGGTTCTCCATGCCACACCTCTCTCCAGGTGCCCTCT
  GCCTCTTCACCCCACAAGAAGCCTTATCCTACGTCCTTCTCTCCATCTATCGGACCCCAGTTTCCATCAC
  TATCTCCAGAGATGTAGCTATTATGCGCCCGTCTACAGGGGGTGCCCGACGATGACGGTGCCTTCGCAGT
  CAAATTACTCTTCGGGTCCCAAGGTTTGGCTTTCACGCGCTCCATTGCCCCGGCGTGGCAGGCCATTCCA
  AGCCCTTCCGGGCTGGAACTGGTGTCGGAGGAGCCTCGGGTGTATCGTACGCCCTGGTGTTGGTGTTGCC
  TCACTCCTCTGAGCTCTTCTTTCTGATCAAGCCCTGCTTAAAGTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_172088.2
• Summary: The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
• Locus ID: 8741