Catalase (CAT) (NM_001752) Human 3' UTR Clone

CAT#: SC208265

3`UTR clone of catalase (CAT) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAT
• Synonyms: MGC138422; MGC138424
• ACCN: NM_001752
• Insert Size: 644 bp
• Sequence Data:
  Insert Sequence

  >SC208265 3'UTR clone of NM_001752
  The sequence shown below is from the reference sequence of NM_001752. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGAAGGCAAATCTGTGAGGCCGGGGCCCTGCACCTGTGCAGCGAAGCTTAGCGTTCATCCGTGTAACC
  CGCTCATCACTGGATGAAGATTCTCCTGTGCTAGATGTGCAAATGCAAGCTAGTGGCTTCAAAATAGAGA
  ATCCCACTTTCTATAGCAGATTGTGTAACAATTTTAATGCTATTTCCCCAGGGGAAAATGAAGGTTAGGA
  TTTAACAGTCATTTAAAAAAAAAATTTGTTTTGACGGATGATTGGATTATTCATTTAAAATGATTAGAAG
  GCAAGTTTCTAGCTAGAAATATGATTTTATTTGACAAAATTTGTTGAAATTATGTATGTTTACATATCAC
  CTCATGGCCTATTATATTAAAATATGGCTATAAATATATAAAAAGAAAAGATAAAGATGATCTACTCAGA
  AATTTTTATTTTTCTAAGGTTCTCATAGGAAAAGTACATTTAATACAGCAGTGTCATCAGAAGATAACTT
  GAGCACCGTCATGGCTTAATGTTTATTCCTGATAATAATTGATCAAATTCATTTTTTTCACTGGAGTTAC
  ATTAATGTTAATTCAGCACTGATTTCACAACAGATCAATTTGTAATTGCTTACATTTTTACAATAAATAA
  TCTGTACGTAAGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001752.3
• Summary: 'This gene encodes catalase, a key antioxidant enzyme in the bodies defense against oxidative stress. Catalase is a heme enzyme that is present in the peroxisome of nearly all aerobic cells. Catalase converts the reactive oxygen species hydrogen peroxide to water and oxygen and thereby mitigates the toxic effects of hydrogen peroxide. Oxidative stress is hypothesized to play a role in the development of many chronic or late-onset diseases such as diabetes, asthma, Alzheimer's disease, systemic lupus erythematosus, rheumatoid arthritis, and cancers. Polymorphisms in this gene have been associated with decreases in catalase activity but, to date, acatalasemia is the only disease known to be caused by this gene. [provided by RefSeq, Oct 2009]'
• Locus ID: 847