HYAL1 (NM_033159) Human 3' UTR Clone

CAT#: SC208321

3`UTR clone of hyaluronoglucosaminidase 1 (HYAL1) transcript variant 7 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HYAL1
• Synonyms: HYAL-1; LUCA1; MPS9; NAT6
• ACCN: NM_033159
• Insert Size: 592 bp
• Sequence Data:
  Insert Sequence

  >SC208321 3'UTR clone of NM_033159
  The sequence shown below is from the reference sequence of NM_033159. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCGGAAGAGCATGTGGTGATTGGCCACACACTGAGTTGCACATATTGAGAACCTAATGCACTCTGGGTC
  TGGCCAGGGCTTCCTCAAATACATGCACAGTCATACAAGTCATGGTCACAGTAAAGAGTACACTCAGCCA
  CTGTCACAGGCATATTCCCTGCACACACATGCATACTTACAGACTGGAATAGTGGCATAAGGAGTTAGAA
  CCACAGCAGACACCATTCATTCCATGTCCATATGCATCTACTTGGCAAGGTCATAGACAATTCCTCCAGA
  GACACTGAGCCAGTCTTTGAACTGCAGCAATCACAAAGGCTGACATTCACTGAGTGCCTACTCTTTGCCA
  ATCCCCGTGCTAAGCGTTTTATGTGGACTTATTCATTCCTCACAATGAGGCTATGAGGAAACTGAGTCAC
  TCACATTGAGAGTAAGCACGTTGCCCAAGGTTGCACAGCAAGAAAAGGGAGAAGTTGAGATTCAAACCCA
  GGCTGTCTAGCTCCGGGGGTACAGCCCTTGCACTCCTACTGAGTTTGTGGTAACCAGCCCTGCACGACCC
  CTGAATCTGCTGAGAGGCACCAGTCCAGCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033159.2
• Summary: 'This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3373