FGR (NM_001042729) Human 3' UTR Clone

CAT#: SC208388

3`UTR clone of Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog (FGR) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FGR
• Synonyms: c-fgr; c-src2; p55-Fgr; p55c-fgr; p58-Fgr; p58c-fgr; SRC2
• ACCN: NM_001042729
• Insert Size: 659 bp
• Sequence Data:
  Insert Sequence

  >SC208388 3'UTR clone of NM_001042729
  The sequence shown below is from the reference sequence of NM_001042729. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCCGCTGAACCACAGTACCAGCCCGGGGATCAGACATAGCCTGTCCGGGCATCAACCCTCTCTGGCGGT
  GGCCACCAGTCCTTGCCAATCCCCAGAGCTGTTCTTCCAAAGCCCCCAGGCTGGCTTAGAACCCCATAGA
  GTCCTAGCATCACCGAGGACGTGGCTGCTCTGACACCACCTAGGGCAACCTACTTGTTTTACAGATGGGG
  CAAAAGGAGGCCCAGAGCTGATCTCTCATCCGCTCTGGCCCCAAGCACTATTTCTTCCTTTTCCACTTAG
  GCCCCTACATGCCTGTAGCCTTTCTCACTCCATCCCCACCCAAAGTGCTCAGACCTTGTCTAGTTATTTA
  TAAAACTGTATGTACCTCCCTCACTTCTCTCCTATCACTGCTTTCCTACTCTCCTTTTATCTCACTCTAG
  TCCAGGTGCCAAGAATTTCCCTTCTACCCTCTATTCTCTTGTGTCTGTAAGTTACAAAGTCAGGAAAAGT
  CTTGGCTGGACCCCTTTCCTGCTGGGTGGATGCAGTGGTCCAGGACTGGGGTCTGGGCCCAGGTTTGAGG
  GAGAAGGTTGCAGAGCACTTCCCACCTCTCTGAATAGTGTGTATGTGTTGGTTTATTGATTCTGTAAATA
  AGTAAAATGACAATATGAATCCTCAAACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001042729.1
• Summary: 'This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]'
• Locus ID: 2268