DPM2 (NM_003863) Human 3' UTR Clone

CAT#: SC208402

3`UTR clone of dolichyl-phosphate mannosyltransferase polypeptide 2 regulatory subunit (DPM2) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DPM2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DPM2
Synonyms CDG1U
ACCN NM_003863
Insert Size 645
Sequence Data
>SC208402 3'UTR clone of NM_003863
The sequence shown below is from the reference sequence of NM_003863. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAGTGACCAAGAAGGCTCAGTGAAGGTCCCGCAGGGATGAGGCTGCCAGCCCCTTCTCTGCTTCCCCTC
CAGCACAGGGACCAAGTGGGGGAGCCTGCAGAACCTGTCCAGGCACAGTGGCTCCTCAAGCCTGCCTGTC
CTGCAGAGTCCCCATGGCATGGAGCTTACACCTGACTGACTGGAGCCCCCTCCCCGACTCCCACTTCCAG
AAGCTAGGAGGGAGGGATACCTGGAAGACTCCGGTCACCTCCTTCTTGCTCAGGGCCTAAAAGATGCTGG
TCCTCCCAACCTCACTCTCAGACTCCCTGCCACCTTTTCCCCTGGGTTCTGCCGTCTTGCCTCACTTCCC
CTCCTGTCACATGCTGACGTTGGACTTAGCAGGTTCTAAGGCCACATGTGTGACCTCTCTGACTTCTCTT
CCTCCACCAAGGCAGCTTTCCTTACCCTGACACAGCCCCAGACCCCACAAAGCCTTCTGGACCTGGAAAG
CCTGGGGAAGGACTGACAGACCCCAGGACCAGCCCTGGGGCTCAGGGCAGCCACCCCGGGCCGCTGACCG
ACTGACCTCTCCTCACGGAGGCCCAGCCCCAAAGCCCCAGGGCTGGCCCGTTTGGGACAGCTGACCAATA
AACACTGATGGTGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003863.3
Summary Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a hydrophobic protein that contains 2 predicted transmembrane domains and a putative ER localization signal near the C terminus. This protein associates with DPM1 in vivo and is required for the ER localization and stable expression of DPM1 and also enhances the binding of dolichol-phosphate to DPM1. [provided by RefSeq, Jul 2008]
Locus ID 8818

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.