ST3GAL6 (NM_006100) Human 3' UTR Clone

CAT#: SC208422

3`UTR clone of ST3 beta-galactoside alpha-23-sialyltransferase 6 (ST3GAL6) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ST3GAL6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ST3GAL6
Synonyms SIAT10; ST3GALVI
ACCN NM_006100
Insert Size 645
Sequence Data
>SC208422 3'UTR clone of NM_006100
The sequence shown below is from the reference sequence of NM_006100. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTCGTAATCAACTTGACTCAAGATTGACTCTACAGACTCAGAAGATGATGCTAACAGTGTTAGTTTTAT
TTTTGTACTGCAATTTTTAGTTTAAAATATGTTGGATGCACTCGTCAAATAATTATGTATACTGTCTGTT
GCTGCCTGGTGATTCATAACCACCAGCTTAATTTCTGTGAATACTGTATATTTAACTTATGAAAACCAAG
AAATGTAAAGATAACAGGAAAATAAGTTTTGATTGCAATGTTTTTAAAATAAGCTAGTTTTCTGAGGTGT
TTTCACACGTCTTTTTATAGTTACTTCATCTTAGATTTTTGAAGGGATATGACTTCCTACTAAGGATTTA
GTTTACCACAACAATTCTGACTACAATAAGACATTTTGAGGAGGATATTTGGCTACTGTAAACATGGCTG
GTGGAAAATCACGATTGTGGCTTGATGTGGCAAGCCGAAACCACTTGGCTCTGGAAATCTAAGTTCATAC
TGGTTTAATTAAGCTCTCTCCTGACAACCCCCAGAATTAAATGAACCATGATTGTGAAGAGTAATTTGGT
ACAATGAAGGCAGTGTTTGTTTTTAAGTTAAAGGAAATGGGCTAAACATAAAGTTCTTATTAGATAAGTA
AATAACTAAAGAAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006100.2
Summary The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
Locus ID 10402

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.