cIAP2 (BIRC3) (NM_182962) Human 3' UTR Clone

CAT#: SC208435

3`UTR clone of baculoviral IAP repeat-containing 3 (BIRC3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BIRC3
• Synonyms: AIP1; API2; c-IAP2; CIAP2; HAIP1; HIAP1; IAP-1; MALT2; MIHC; RNF49
• ACCN: NM_182962
• Insert Size: 678 bp
• Sequence Data:
  Insert Sequence

  >SC208435 3'UTR clone of NM_182962
  The sequence shown below is from the reference sequence of NM_182962. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTTGTAGGAGTACAATCAAGGGTACAGTTCGTACATTTCTTTCATGAAGAAGAACCAAAACATCGTCTAA
  ACTTTAGAATTAATTTATTAAATGTATTATAACTTTAACTTTTATCCTAATTTGGTTTCCTTAAAATTTT
  TATTTATTTACAACTCAAAAAACATTGTTTTGTGTAACATATTTATATATGTATCTAAACCATATGAACA
  TATATTTTTTAGAAACTAAGAGAATGATAGGCTTTTGTTCTTATGAACGAAAAAGAGGTAGCACTACAAA
  CACAATATTCAATCAAAATTTCAGCATTATTGAAATTGTAAGTGAAGTAAAACTTAAGATATTTGAGTTA
  ACCTTTAAGAATTTTAAATATTTTGGCATTGTACTAATACCGGGAACATGAAGCCAGGTGTGGTGGTATG
  TGCCTGTAGTCCCAGGCTGAGGCAAGAGAATTACTTGAGCCCAGGAGTTTGAATCCATCCTGGGCAGCAT
  ACTGAGACCCTGCCTTTAAAAACAAACAGAACAAAAACAAAACACCAGGGACACATTTCTCTGTCTTTTT
  TGATCAGTGTCCTATACATCGAAGGTGTGCATATATGTTGAATGACATTTTAGGGACATGGTGTTTTTAT
  AAAGAATTCTGTGAGAAAAAATTTAATAAAGCAACAAAAATTACTCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_182962.1
• Summary: 'This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]'
• Locus ID: 330