Inhibin beta A (INHBA) (NM_002192) Human 3' UTR Clone

CAT#: SC208451

3`UTR clone of inhibin beta A (INHBA) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "INHBA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol INHBA
Synonyms EDF; FRP
ACCN NM_002192
Insert Size 649 bp
Sequence Data
>SC208451 3'UTR clone of NM_002192
The sequence shown below is from the reference sequence of NM_002192. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATGATCGTGGAGGAGTGTGGGTGCTCATAGAGTTGCCCAGCCCAGGGGGAAAGGGAGCAAGAGTTGTCC
AGAGAAGACAGTGGCAAAATGAAGAAATTTTTAAGGTTTCTGAGTTAACCAGAAAAATAGAAATTAAAAA
CAAAACAAAAAAAAAAACAAAAAAAAACAAAAGTAAATTAAAAACAAAACCTGATGAAACAGATGAAGGA
AGATGTGGAAAAAATCCTTAGCCAGGGCTCAGAGATGAAGCAGTGAAAGAGACAGGAATTGGGAGGGAAA
GGGAGAATGGTGTACCCTTTATTTCTTCTGAAATCACACTGATGACATCAGTTGTTTAAACGGGGTATTG
TCCTTTCCCCCCTTGAGGTTCCCTTGTGAGCCTTGAATCAACCAATCTAGTCTGCAGTAGTGTGGACTAG
AACAACCCAAATAGCATCTAGAAAGCCATGAGTTTGAAAGGGCCCATCACAGGCACTTTCCTACCCAATT
ACCCAGGTCATAAGGTATGTCTGTGTGACACTTATCTCTGTGTATATCAGCATACACACACACACACACA
CACACACACACACACACAGGCATTTCCACACATTACATATATACACATACTGGTAAAAGAACAATCGTGT
GCAGGTGGTCACACTTCCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002192.2
Summary 'This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. The encoded protein also plays a role in eye, tooth and testis development. Elevated expression of this gene may be associated with cancer cachexia in human patients. [provided by RefSeq, Aug 2016]'
Locus ID 3624

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.