galectin 9 (LGALS9) (NM_002308) Human 3' UTR Clone

CAT#: SC208482

3`UTR clone of lectin galactoside-binding soluble 9 (LGALS9) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LGALS9
• Synonyms: HUAT; LGALS9A
• ACCN: NM_002308
• Insert Size: 598 bp
• Sequence Data:
  Insert Sequence

  >SC208482 3'UTR clone of NM_002308
  The sequence shown below is from the reference sequence of NM_002308. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTG
  GGTCCTCTCATCATCCCCACTTCCCAGGCCCAGCCTTTCCAACCCTGCCTGGGATCTGGGCTTTAATGCA
  GAGGCCATGTCCTTGTCTGGTCCTGCTTCTGGCTACAGCCACCCTGGAACGGAGAAGGCAGCTGACGGGG
  ATTGCCTTCCTCAGCCGCAGCAGCACCTGGGGCTCCAGCTGCTGGAATCCTACCATCCCAGGAGGCAGGC
  ACAGCCAGGGAGAGGGGAGGAGTGGGCAGTGAAGATGAAGCCCCATGCTCAGTCCCCTCCCATCCCCCAC
  GCAGCTCCACCCCAGTCCCAAGCCACCAGCTGTCTGCTCCTGGTGGGAGGTGGCCTCCTCAGCCCCTCCT
  CTCTGACCTTTAACCTCACTCTCACCTTGCACCGTGCACCAACCCTTCACCCCTCCTGGAAAGCAGGCCT
  GATGGCTTCCCACTGGCCTCCACCACCTGACCAGAGTGTTCTCTTCAGAGGACTGGCTCCTTTCCCAGTG
  TCCTTAAAATAAAGAAATGAAAATGCTTGTTGGCACAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002308.3
• Summary: 'The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 3965