TOR2A (NM_001134430) Human 3' UTR Clone

CAT#: SC208513

3`UTR clone of torsin family 2 member A (TOR2A) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TOR2A"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TOR2A
Synonyms TORP1
ACCN NM_001134430
Insert Size 634
Sequence Data
>SC208513 3'UTR clone of NM_001134430
The sequence shown below is from the reference sequence of NM_001134430. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGGAGCCAAGGGATGAGGTTGTCCAGGCTGTGCTGGACAGCACCACCTTCTTCCCTGAAGACGAGCAGC
TCTTCTCCTCCAACGGCTGCAAGACCGTGGCCTCCCGAATCGCCTTCTTCCTCTGACTCTCTGAGTGGTG
TCCTCGGCCCCCCTGATGGCCAGGCCATGCAGGAAAGGCCAGGGGCCTCTGTCACAGGAACCCAGAGCAC
CAAGTGAGATGAACGGAGTGTCGGCTAGGCCACGGGACAGATGGCCAGGAAGGGCCCTGGCCTCTAAACT
GGCTCGAGAGCATCTTGGCCCCGGCCACCTTCCCCAGGGAAACCCCTGGTCACCCCAGAACCTCACTGAG
CCTTGACCTCCCCCTGCAGCCTGAGCCTTCTTACTGTGAATTATAACTCAGGGACTGTGGCTCGTGGCGG
TGCTCCCTCCTCAGTCTGCCACCCTTGCCCCTTGCCTCCTTGGTCGGGCACCATACCTCCTCCCCTCCAC
CCCACACCCTGTGTCCATATCAAGCCAGGTGGAGCCTTCTCAGTTTCCAGAAATGGAGGGACTCAAGCTG
CCACTTGGGCCTGGTTTTAGATGTTTTTAATTTTGTAAAAGAAAACAAGTATAATAAACTCAGCTGTGGG
ACCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001134430.1
Summary This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014]
Locus ID 27433

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.