P2X5 (P2RX5) (NM_002561) Human 3' UTR Clone

CAT#: SC208530

3`UTR clone of purinergic receptor P2X ligand-gated ion channel 5 (P2RX5) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "P2RX5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol P2RX5
Synonyms LRH-1; P2X5; P2X5R
ACCN NM_002561
Insert Size 659 bp
Sequence Data
>SC208530 3'UTR clone of NM_002561
The sequence shown below is from the reference sequence of NM_002561. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACGGATCTGTGTGCCCACAGCTCCTGGAGCCCCACAGGAGCACGTGAATTGCCTCTGCTTACGTTCAGGC
CCTGTCCTAAACCCAGCCGTCTAGCACCCAGTGATCCCATGCCTTTGGGAATCCCAGGATGCTGCCCAAC
GGGAAATTTGTACATTGGGTGCTATCAATGCCACATCACAGGGACCAGCCATCACAGAGCAAAGTGACCT
CCACGTCTGATGCTGGGGTCATCAGGACGGACCCATCATGGCTGTCTTTTTGCCCCACCCCCTGCCGTCA
GTTCTTCCTTTCTCCGTGGCTGGCTTCCCGCACTAGGGAACGGGTTGTAAATGGGGAACATGACTTCCTT
CCGGAGTCCTTGAGCACCTCAGCTAAGGACCGCAGTGCCCTGTAGAGTTCCTAGATTACCTCACTGGGAA
TAGCATTGTGCGTGTCCGGAAAAGGGCTCCATTTGGTTCCAGCCCACTCCCCTCTGCAAGTGCCGCAGCT
TCCCTCAGAGCATACTCTCCAGTGGATCCAAGTACTCTCTCTCCTAAAGACACCACCTTCCTGCCAGCTG
TTTGCCCTTAGGCCAGTACACAGAATTAAAGTGGGGGAGATGGCAGACGCTTTCTGGGACCTGCCCAAGA
TATGTATTCTCTGACACTCTTATTTGGTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002561.2
Summary 'The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]'
Locus ID 5026

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.