ERK1 (MAPK3) (NM_001109891) Human 3' UTR Clone

CAT#: SC208618

3`UTR clone of mitogen-activated protein kinase 3 (MAPK3) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPK3
• Synonyms: ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3
• ACCN: NM_001109891
• Insert Size: 653 bp
• Sequence Data:
  Insert Sequence

  >SC208618 3'UTR clone of NM_001109891
  The sequence shown below is from the reference sequence of NM_001109891. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAGCCCAGACAGACATCTCTGCACCC
  TGGGGCCTGGACCTGCCTCCTGCCTGCCCCTCTCCCGCCAGACTGTTAGAAAATGGACACTGTGCCCAGC
  CCGGACCTTGGCAGCCCAGGCCGGGGTGGAGCATGGGCCTGGCCACCTCTCTCCTTTGCTGAGGCCTCCA
  GCTTCAGGCAGGCCAAGGCCTTCTCCTCCCCACCCGCCCTCCCCACGGGGCCTCGGGACCTCAGGTGGCC
  CCAGTTCAATCTCCCGCTGCTGCTGCTGCGCCCTTACCTTCCCCAGCGTCCCAGTCTCTGGCAGTTCTGG
  AATGGAAGGGTTCTGGCTGCCCCAACCTGCTGAAGGGCAGAGGTGGAGGGTGGGGGGCGCTGAGTAGGGA
  CTCAGGGCCATGCCTGCCCCCCTCATCTCATTCAAACCCCACCCTAGTTTCCCTGAAGGAACATTCCTTA
  GTCTCAAGGGCTAGCATCCCTGAGGAGCCAGGCCGGGCCGAATCCCCTCCCTGTCAAAGCTGTCACTTCG
  CGTGCCCTCGCTGCTTCTGTGTGTGGTGAGCAGAAGTGGAGCTGGGGGGCGTGGAGAGCCCGGCGCCCCT
  GCCACCTCCCTGACCCGTCTAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001109891.1
• Summary: 'The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]'
• Locus ID: 5595