NDUFV3 (NM_001001503) Human 3' UTR Clone

CAT#: SC208624

3`UTR clone of NADH dehydrogenase (ubiquinone) flavoprotein 3 10kDa (NDUFV3) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFV3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NDUFV3
Synonyms CI-9KD; CI-10k
ACCN NM_001001503
Insert Size 633 bp
Sequence Data
>SC208624 3'UTR clone of NM_001001503
The sequence shown below is from the reference sequence of NM_001001503. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGTCACCTCGACACTGAGGGCCCTCGGTGTGAAGATGAACCTTCCACCGTCTTCACTGCATCCTGGAGT
GCAAAAATAAAATCCACTCAAGAGTCACAAGGCCCGCTGTGCATAATCGGTTTCACTTTTACCTTTTTTT
TTTTTTTTTTTTTTTTGAGACAGGGTCTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCACATTCTCGGC
TCACTGCAACTTCCGCCTCCTGGGTTCAAGTGATTCTCCCACCTCAGCCTCCCAAGTAGGTGGGATTACA
GGTACTCACCACCAGGTCCAGCTAACTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGG
CTGGTCTCGAACTCCTGACCTCAGATGGTCTGCCCACCTCCGCCTCCCAAAGTGCTGGGATTACAGGCGT
GAGCCACTGCGCCCGGCCACTTTCACACTTTTTACAGTGAGTGGTGAATTAGCAACAGTAACACTGATTA
TCCAACATATATTTTGGAATATCTACTATGTGCAAGGAATTTTTCTTAAACTCTAAGGTTATGAATCACT
GGGCAAATCCATATAATTAGAGAATTTTAAGTGCTTTAGAGCGGTGTGATTCTACTGTGCTCAGCCTAGT
CAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001001503.1
Summary 'The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 4731

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.