SLP76 (LCP2) (NM_005565) Human 3' UTR Clone

CAT#: SC208631

3`UTR clone of lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) (LCP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LCP2
• Synonyms: SLP-76; SLP76
• ACCN: NM_005565
• Insert Size: 626 bp
• Sequence Data:
  Insert Sequence

  >SC208631 3'UTR clone of NM_005565
  The sequence shown below is from the reference sequence of NM_005565. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGTGCACATTAACGCATGCTGCAGGGTACCCATAGCAAGTTATAGCCGAGCAAATGAACCGTCCTCCTG
  CCTCTGTTGCCAACACGAGATCAATCAGCCTTGGTCAATGGACAAACACTTAGGACTGAACTGAACCCCT
  CCCCATGAACACAAGGGTTTTATCCTTTCCTTTAAAAACAGTGTTTGAAATGAAGACTGTCAACTATCCC
  ATAATTTATTTATTCTTCTTCAATGTTTGTAAAGTGCATGAGTCATGTTCACACTTGAAGTCTAGTAGTG
  CACTGTAATAATTCATTTTTTAAAAGATTATTTAATGCCCATTTCAAAATACAGTAGTTTACACAGCTAC
  AGAAACAATTTGGGGCAAGTTTTAAAACACTGAAACAGTAATAGTTATTGGTGTCACATAAAACTGATTT
  GTTTTTTACAGCCAAACCTCTGTCAGTCAGAGGCATTCATTAGTTTTATACATGTAATTTGAAAATCACT
  AAACCTCGTTTTCTCAGCAGCAATAATTTAAGAGGCTTCAAAAATATAATTTCACTCTTATTTAGTATTT
  TTTCCTGGGGGCATTTTTACGTAATTTTTTTATGAAAAGACAAATGCATGTTGAGATAACTTCTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005565.3
• Summary: 'This gene encodes an adapter protein that acts as a substrate of the T cell antigen receptor (TCR)-activated protein tyrosine kinase pathway. The encoded protein associates with growth factor receptor bound protein 2, and is thought to play a role TCR-mediated intracellular signal transduction. A similar protein in mouse plays a role in normal T-cell development and activation. Mice lacking this gene show subcutaneous and intraperitoneal fetal hemorrhaging, dysfunctional platelets and impaired viability. [provided by RefSeq, Nov 2016]'
• Locus ID: 3937