MLKL (NM_152649) Human 3' UTR Clone

CAT#: SC208650

3`UTR clone of mixed lineage kinase domain-like (MLKL) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MLKL"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MLKL
Synonyms hMLKL
ACCN NM_152649
Insert Size 644
Sequence Data
>SC208650 3'UTR clone of NM_152649
The sequence shown below is from the reference sequence of NM_152649. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAACTCTCCACCTTTTCTAAGTAGTGTATCAAAATCTAAACCAAGGAGTCTCTGGACAAGAAGCTGGGAG
AGGCACAAACTGGACATCTCTCTCTCTCATATCCTTCGGCATTGGGTTATCTATGGGTGCAAGGAGTGGG
CACGCTTCTCTGTTACAAATAGAAAACGATTCCAGTCATACAGGACACATCCCACTCCAAATGATATTTC
CAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCT
CTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGC
TGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTT
TCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGA
ATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGC
TAACACATGAATGAGGCCAATCAAGACCAGAAGAACCACTCAAGCAGATCCCAGCCCAAATTGCCCATTC
ACACAATCAGGAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152649.2
Summary This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to be inactive because it lacks several residues required for activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (RIP3), which is a key signaling molecule in necroptosis pathway. Inhibitor studies and knockdown of this gene inhibited TNF-induced necrosis. High levels of this protein and RIP3 are associated with inflammatory bowel disease in children. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2015]
Locus ID 197259

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.