HLA-DPB1 (NM_002121) Human 3' UTR Clone

CAT#: SC208651

3`UTR clone of major histocompatibility complex class II DP beta 1 (HLA-DPB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DPB1
• Synonyms: DPB1; HLA-DP; HLA-DP1B; HLA-DPB
• ACCN: NM_002121
• Insert Size: 686 bp
• Sequence Data:
  Insert Sequence

  >SC208651 3'UTR clone of NM_002121
  The sequence shown below is from the reference sequence of NM_002121. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCATGCACAGGAGGAGCAAGAAAGTTCAACGAGGATCTGCATAAACAGGGTTCCTGAGCTCACTGAAAAG
  ACTATTGTGCCTTAGGAAAAGCATTTGCTGTGTTTCGTTAGCATCTGGCTCCAGGACAGACCTTCAACTT
  CCAAATTGGATACTGCTGCCAAGAAGTTGCTCTGAAGTCAGTTTCTATCATTCTGCTCTTTGATTCAAAG
  CACTGTTTCTCTCACTGGGCCTCCAACCATGTTCCCTTCTTCTTAGCACCACAAATAATCAAAACCCAAC
  ATGACTGTTTGTTTTCCTTTAAAAATATGCACCAAATCATCTCTCATCACTTTTCTCTGAGGGTTTTAGT
  AGACAGTAGGAGTTAATAAAGAAGTTCATTTTGGTTTAAACATAGGAAAGAAGAGAACCATGAAAATGGG
  GATATGTTAACTATTGTATAATGGGGCCTGTTACACATGACACTCTTCTGAATTGACTGTATTTCAGTGA
  GCTGCCCCCAAATCAAGTTTAGTGCCCTCATCCATTTATGTCTCAGACCACTATTCTTAACTATTCAATG
  GTGAGCAGACTGCAAATCTGCCTGATAGGACCCATATTCCCACAGCACTAATTCAACATATACCTTACTG
  AGAGCATGTTTTATCATTACCATTAAGAAGTTAAATGAACATCAGAATTTAAAATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002121.4
• Summary: 'HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]'
• Locus ID: 3115