CYP7B1 (NM_004820) Human 3' UTR Clone

CAT#: SC208711

3`UTR clone of cytochrome P450 family 7 subfamily B polypeptide 1 (CYP7B1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CYP7B1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CYP7B1
Synonyms CBAS3; CP7B; SPG5A
ACCN NM_004820
Insert Size 701
Sequence Data
>SC208711 3'UTR clone of NM_004820
The sequence shown below is from the reference sequence of NM_004820. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTATCCAGATTCTGATGTTTTATTTAGATACAAAGTGAAATCTTAGAGAAGCTAAAAGGAAAGAAAATA
AATCTATCAAAATTACCCTAAACATCCTAAGCTCATCTATTTCTTTTTAATTTCTGCAAATGTAATTGAT
TTATTTGTTTAAAAAGCGCTAATTTCTATTTGATCTGATATCAGTCCAGTTTGTCCTTAGTCACAAAGCC
CATCATAATATAAAACAGGATGGTGGCAGGAAAATGGACATCAAAATCAACTTAAGGGTAGGCTCAAAAC
AGGGTTGTTGTTGTTTTTTTAGTTTCTCCTTGTTGTGATTTTCACCTGTTATAATAAATGTACCTTCACA
CCAATAGATTGGGCACTGTGGAATTTAAATCACTCAAATTGTTCTCTAATATGTAAAATTACACTTTGAA
CTACTAGAAAATTGTGCTGGAAATGGACACAGTCTAACAAATTCCAAATTCTCACAGAAGAAGGAAATTG
AATTTCCATGAGTTACACTGGATGAAAATGTTCCCTTCAAGTATAATATTAATAATACCTATATTTCCAG
GGTATGTGTGCATTAAATGAGTTTCACAGTAGATTGAATGCTTCAACTTCACTTCAATATTTAATCATGC
ATAAATGTTCCTTATTACTTTGTATACTATGGCTCAATAGAACAAAATTTCTGGTTACATAAGACCTTTC
A

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004820.3
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
Locus ID 9420

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.