IL12RB1 (NM_153701) Human 3' UTR Clone

CAT#: SC208722

3`UTR clone of interleukin 12 receptor beta 1 (IL12RB1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL12RB1
• Synonyms: CD212; IL-12R-BETA1; IL12RB; IMD30
• ACCN: NM_153701
• Insert Size: 670 bp
• Sequence Data:
  Insert Sequence

  >SC208722 3'UTR clone of NM_153701
  The sequence shown below is from the reference sequence of NM_153701. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATTACAGGCATCTGCCACCATACCCGGCTAATTTTGTATTTTTAGTAGAGACGGGGTTTCACCACGTT
  GGCCAGGCTGGTCTCGAACTCCTGACCTCAAGTGATCCACCTGCCTTGGCCTCCCAAAGTGTTGGGATTA
  TAGGCGTGAGCCACCATGCCCAGCCTAATTTTTGTATTTTTAGTAGAGATGGAGTTTCACCATGTTGCCC
  AGGCTGGTCTCAAACTCCTGCCCTCAGGTGATCCACCCACCTCAGCCTCTCAAAGTGCTGGGATTACAGG
  TGTGAGCCACTGTGGCCGACCTACTATTTTTATTATTTTTGAGCTAGGTTCTCAGTCTGTTGGCAGACTG
  GAGTGCAATCATGGCTCACTGCAGCCTTGAACTCCCAGACTCAAGTGATCCTTCCACCTCAGCCTCTGGA
  GTAGCTGGGACTACAGACATGCACCACCACACCTGGTTAATTTTTTATTTTTATTTTTTGTAGAGACAGG
  TGTCTCTCTACGTTGCCCAGGCTGGTCTCGAACTCCTGGGCTCAAGTGATCCACCCATCTCCACCTCCCA
  AAGTGCTAGGATTACAGGCGTGAGCCACCGTACCCAGCCTGGTCCCATATCATAGTGAAATGGTGCCTGT
  AAAGCTCTCAGCATTGGCTTGGCACATGCAGTTGGTACTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_153701.1
• Summary: 'The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]'
• Locus ID: 3594