ELK3 (NM_005230) Human 3' UTR Clone

CAT#: SC208811

3`UTR clone of ELK3 ETS-domain protein (SRF accessory protein 2) (ELK3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ELK3
• Synonyms: ERP; NET; SAP-2; SAP2
• ACCN: NM_005230
• Insert Size: 694 bp
• Sequence Data:
  Insert Sequence

  >SC208811 3'UTR clone of NM_005230
  The sequence shown below is from the reference sequence of NM_005230. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCTGCTTCTCCAGTACTGCTTTCTTCAAACTCTCAGAAATCCTGATGACGTCTGGCCACAATTAAGGA
  CTCATTAACTGATGAAACAAATTTGTCCCCACGGGCTAGTTTACCTGTGTCGTGAGAAGGACATTGTGAA
  ACTCTTGTTAATTTGGTTTGCACTTTTCATAACATGGATAGTCTAGATTTATGTTAGCATTTTAAAAACT
  GTTTTTGATATATTCAAGTATATATGAAAATCTGTTTGGCATTAAGTGAATTTTAATGTTTTTGTTTTTA
  TATCCTTTTAGCTCTTAAGTGTTGAACACTGTTGACAGTGAAGAACTTTTCTTAATGGTTTTCAGTATAA
  CTAATAAGGATGTGAAGCTTTTTTCTCTTTAGTTCTGAGTATGCTAAACTGTGTGCTTATATAGACTATA
  ACCAGTTGTGCCTTCCTTTGCATTTAATGTAAATGAATGATTTATATATTTTTTAGTATTAAGAGGAAAT
  GTTTGAAAGATGAAAATTAGTATCAAACAGCTCTCTAGTAGAATTTCATTATTTTTCACCAGTGGGCAAT
  ATGAAAGCATATATCACGTTTTGTTTTACTTTCAATTGTATAAGAATTGCCTTAGAACCTCTTTTGAACT
  GAAATTCAGTAAATGTCCAAGTAATGTTTTTATAATAAACTAAGCCATATTTAGACAATAAACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005230.2
• Summary: 'This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]'
• Locus ID: 2004