LILRB1 (NM_001081637) Human 3' UTR Clone

CAT#: SC208822

3`UTR clone of leukocyte immunoglobulin-like receptor subfamily B (with TM and ITIM domains) member 1 (LILRB1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LILRB1
• Synonyms: CD85J; ILT-2; ILT2; LIR-1; LIR1; MIR-7; MIR7; PIR-B; PIRB
• ACCN: NM_001081637
• Insert Size: 675
• Sequence Data:
  Insert Sequence

  >SC208822 3'UTR clone of NM_001081637
  The sequence shown below is from the reference sequence of NM_001081637. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCATCTACGCCACTCTGGCCATCCACTAGCCCAGGGGGGGACGCAGACCCCACACTCCATGGAGTCTG
  GAATGCATGGGAGCTGCCCCCCCAGTGGACACCATTGGACCCCACCCAGCCTGGATCTACCCCAGGAGAC
  TCTGGGAACTTTTAGGGGTCACTCAATTCTGCAGTATAAATAACTAATGTCTCTACAATTTTGAAATAAA
  GCAACAGACTTCTCAATAATCAATGAAGTAGCTGAGAAAACTAAGTCAGAAAGTGCATTAAACTGAATCA
  CAATGTAAATATTACACATCAAGCGATGAAACTGGAAAACTACAAGCCACGAATGAATGAATTAGGAAAG
  AAAAAAAGTAGGAAATGAATGATCTTGGCTTTCCTATAAGAAATTTAGGGCAGGGCACGGTGGCTCACGC
  CTGTAATTCCAGCACTTTGGGAGGCCGAGGCGGGCAGATCACGAGTTCAGGAGATCGAGACCATCTTGGC
  CAACATGGTGAAACCCTGTCTCTCCTAAAAATACAAAAATTAGCTGGATGTGGTGGCAGTGCCTGTAATC
  CCAGCTATTTGGGAGGCTGAGGCAGGAGAATCGCTTGAACCAGGGAGTCAGAGGTTTCAGTGAGCCAAGA
  TCGCACCACTGCTCTCCAGCCTGGCGACAGAGGGAGACTCCATCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001081637.1
• Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 10859