MCM2 (NM_004526) Human 3' UTR Clone

CAT#: SC208847

3`UTR clone of minichromosome maintenance complex component 2 (MCM2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MCM2
• Synonyms: BM28; CCNL1; cdc19; CDCL1; D3S3194; DFNA70; MITOTIN
• ACCN: NM_004526
• Insert Size: 676 bp
• Sequence Data:
  Insert Sequence

  >SC208847 3'UTR clone of NM_004526
  The sequence shown below is from the reference sequence of NM_004526. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCCACGACCTGAAAAGGAAAATGATCCTGCAGCAGTTCTGAGGCCCTATGCCATCCATAAGGATTCCT
  TGGGATTCTGGTTTGGGGTGGTCAGTGCCCTCTGTGCTTTATGGACACAAAACCAGAGCACTTGATGAAC
  TCGGGGTACTAGGGTCAGGGCTTATAGCAGGATGTCTGGCTGCACCTGGCATGACTGTTTGTTTCTCCAA
  GCCTGCTTTGTGCTTCTCACCTTTGGGTGGGATGCCTTGCCAGTGTGTCTTACTTGGTTGCTGAACATCT
  TGCCACCTCCGAGTGCTTTGTCTCCACTCAGTACCTTGGATCAGAGCTGCTGAGTTCAGGATGCCTGCGT
  GTGGTTTAGGTGTTAGCCTTCTTACATGGATGTCAGGAGAGCTGCTGCCCTCTTGGCGTGAGTTGCGTAT
  TCAGGCTGCTTTTGCTGCCTTTGGCCAGAGAGCTGGTTGAAGATGTTTGTAATCGTTTTCAGTCTCCTGC
  AGGTTTCTGTGCCCCTGTGGTGGAAGAGGGCACGACAGTGCCAGCGCAGCGTTCTGGGCTCCTCAGTCGC
  AGGGGTGGGATGTGAGTCATGCGGATTATCCACTCGCCACAGTTATCAGCTGCCATTGCTCCCTGTCTGT
  TTCCCCACTCTCTTATTTGTGCATTCGGTTTGGTTTCTGTAGTTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004526.2
• Summary: 'The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]'
• Locus ID: 4171