OSBPL9 (NM_148909) Human 3' UTR Clone

CAT#: SC208938

3`UTR clone of oxysterol binding protein-like 9 (OSBPL9) transcript variant 7 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "OSBPL9"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol OSBPL9
Synonyms ORP-9; ORP9
ACCN NM_148909
Insert Size 680
Sequence Data
>SC208938 3'UTR clone of NM_148909
The sequence shown below is from the reference sequence of NM_148909. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGAAACGTCTTGGTGCTGCCAAGCATTAGGTTGGAAGATGCAAAGTTTATACCTGATGATCAGGGCAGT
AGGCATAATTCAGCAACAAACAATCTTCCTTTGGGAGAAACCTGTTCATTCCAATCTTCTAATTACAGTG
GTTCCTATCTCAGGGATACTGGACTTTCTGACGCAGATGAACAATTAAGGGGAAAAGCTTCCCTTTTCCC
TCTGTGGCAGTTACGATTTTGACTTCAGTCCTGAGAAAAACTTCAGGTTTTGAAAATCAGATGATGTCTT
CTCCTTTTCCAAACACCACACGTTGAAAGCATTTATAAATCCAAGTCTGAAACTCTGCGCTCTAGTACTG
CTGTTAAGATACACAACTTGTTTCTTAGTTCATATAATCTCGGGATACACACACACACACACATATATAT
ACACACACATACGTATACACACACATACATATATATAAATATACCTGATGCCAGATTTTTTTCATAAATA
TTCTGCCTACTGTAAATATGGGTTCCTCTGAGTTGTTTTAGAAAATTAGCGCAATGTATTAAAATCAAGT
GTTAGGAAATTTCATGGTCTTACCTACAATAACTTTTATTTTGGAATTGAACTATTATTAAATTGTATCT
AATCCTGGATTACAGTTTAATTAATTATTCTTAGTGCTTAAGGCTTCATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_148909.1
Summary This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Locus ID 114883

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.